What a BLONDE will ask the doctor in the maternity ward?

A: "Is it mine "

Previous Random Joke Next

Blonde Jokes More Blonde Jokes

How many blondes does it take to change a diaper?

Ask Hugh Hefner.

Why do blondes wear underwear?

To keep their ankles warm.

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What does a quantum physicist tell their toddler who keeps asking "Why" over and over?

Because I saw so."

Doctor Jokes More Doctor Jokes

Why didn't the doctor use Twitter to tell the patient that he had a deadly disease?

Because the condition was untweetable.

Which Doctor would you like to see?

Me: I'd like to be able to see all of them. That's why I'm here.