What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What do I owe ya?

asks the neutron. "For you No charge."

What did the cannibal ask for in his burrito?

Human beans

Bartender Jokes More Bartender Jokes

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

How do you encourage a bartender?

That's the spirit!" How do you discourage a bartender Boos.