What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

When ur at chipotle n u ask for guac and they say "its extra is that ok?

if u say its not ok they give it to u for free

What's the difference between Pizza and your opinion?

I asked for Pizza #KingOfjokes

Bartender Jokes More Bartender Jokes

Why the long face ?

A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.

What can I get you ?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.