What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What did the large furry mammal say when the salamander who kept asking for favors went too far?

I can't bear it! You axolotl of me this time!

How do you know Axe was invented by black people?

If it was white people who invented it, it would be called Ask.

Bartender Jokes More Bartender Jokes

How much will that be?

asks the neutron. "For you " replies the bartender, "no charge."

What did the brown dwarf say to the bartender?

I'd like a Corona, please.