Bartender Jokes

What's the difference between a mixologist and a bartender?

About ten minutes.

Couple's Daily Question Mug

5.0

Coffee Mug

How do you pay a bartender?

With bar tender.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What did the bartender say to the alien?

You're drunk ET, go home!"

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What did the drunk Chinese customer say to the bartender?

No have to cut me off. Fall off barstool by myself. end metajoke

Why does Jesus and bartenders have so much in common?

Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.

Why the long face ?

A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the straight edge ghost say to the bartender?

No boos for me.

Interactive Joke of the Day Mug

5.0

Coffee Mug

What did the bartender say to the horse?

bartender: Why the long face Horse: My alcoholism is destroying my family.

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

Why the wrong face?

the bartender says.

How much for a beer?

The bartender replies: "For you No charge."

What'll ya have?

Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

Why the sad face?

asks the bartender. "I got fired."

What did the bartender say to the jumper cables when they walked into the bar?

A: Ok you 2 dont start anything

How much for a drink?

The bartender replies, "For you No charge."

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What did the bartender say to the jumper cables?

You better not try to start anything.

Why the long pause?

asks the bartender. The bear replies "Well, I am a bear"

How'd ya get that?

asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.

What did the bartender say to the angry speaker?

We don't want any treble

What did the bartender say to the foreskin?

You're cut off."

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Who's the new guy?

And the bartender says, I don't know, but I've heard he's a shady character!

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What can I get you ?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

What in the world is this?

The bartender says, "Central Park."

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

When he finishes drinking, he pulls out his wallet and say to the Bartender, "How much?

The Bartender says, "For you No charge."

How much will that be?

asks the neutron. "For you " replies the bartender, "no charge."

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!"

How do you encourage a bartender?

That's the spirit!" How do you discourage a bartender Boos.

Where is all the color white?

Bartender says, "dude, this is a gray bar.

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

A DHCP packet walks into a bar and asks for a beer.

Bartender says, "here, but I’ll need that back in an hour!"

You might also enjoy:

Need Jokes More Need Jokes

How many black people are needed to change a light bulb?

One less now, because the one who tried to steal the light bulb was shot by the cops.

Why haven't they sent a woman to the moon?

It doesn't need cleaning

Neutron Jokes More Neutron Jokes

How much will that be?

asks the neutron. "For you " replies the bartender, "no charge."

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Bar Tender Jokes More Bar Tender Jokes

How do you pay a bartender?

With bar tender.

What do you use to buy drinks?

Bar tender

Want Jokes More Want Jokes

What' chu want fam?

The Vietnamese person replies, "How do you know my name "

What are some easy pranks I can set up in his cubicle?

I don't want to go TOO over the top, and I definitely don't want to actually damage anything. But he has a pretty good sense of humor.

Destroy Jokes More Destroy Jokes

Why are hurricanes always named after white people?

Because white people destroy everything.

When is it acceptable to not tip your server?

when your a system admin, and your server if tipped could destroy many websites.

Alcoholism Jokes More Alcoholism Jokes

What did the bartender say to the horse?

bartender: Why the long face Horse: My alcoholism is destroying my family.

What's the difference between alcoholism and a lobotomy?

I'd rather have a bottle in front of me than a frontal lobotomy.

Idk Jokes More Idk Jokes

What does IDK mean?

I've yet to find someone who knows.

How many dothraki does it take to open a door?

Idk, but they sure are hot.

Family Jokes More Family Jokes

When you guys describe me to your families do you use the word tigress?

I'd prefer if you included tigress

What's the difference between a raft guide and a large pizza?

A large pizza can feed a family.