Bartender Jokes

What's the difference between a mixologist and a bartender?

About ten minutes.

Couple's Daily Question Mug

Couple's Daily Question Mug

Coffee Mug

How do you pay a bartender?

With bar tender.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What did the bartender say to the alien?

You're drunk ET, go home!"

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What did the drunk Chinese customer say to the bartender?

No have to cut me off. Fall off barstool by myself. end metajoke

Why does Jesus and bartenders have so much in common?

Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.

Why the long face ?

A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the straight edge ghost say to the bartender?

No boos for me.

Interactive Joke of the Day Mug

Interactive Joke of the Day Mug

Coffee Mug

What did the bartender say to the horse?

bartender: Why the long face Horse: My alcoholism is destroying my family.

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

Why the wrong face?

the bartender says.

How much for a beer?

The bartender replies: "For you No charge."

What'll ya have?

Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

Why the sad face?

asks the bartender. "I got fired."

What did the bartender say to the jumper cables when they walked into the bar?

A: Ok you 2 dont start anything

How much for a drink?

The bartender replies, "For you No charge."

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What did the bartender say to the jumper cables?

You better not try to start anything.

Why the long pause?

asks the bartender. The bear replies "Well, I am a bear"

How'd ya get that?

asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.

What did the bartender say to the angry speaker?

We don't want any treble

What did the bartender say to the foreskin?

You're cut off."

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Who's the new guy?

And the bartender says, I don't know, but I've heard he's a shady character!

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What can I get you ?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

What in the world is this?

The bartender says, "Central Park."

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

When he finishes drinking, he pulls out his wallet and say to the Bartender, "How much?

The Bartender says, "For you No charge."

How much will that be?

asks the neutron. "For you " replies the bartender, "no charge."

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!"

How do you encourage a bartender?

That's the spirit!" How do you discourage a bartender Boos.

Where is all the color white?

Bartender says, "dude, this is a gray bar.

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

A DHCP packet walks into a bar and asks for a beer.

Bartender says, "here, but I’ll need that back in an hour!"

You might also enjoy:

Ask Jokes More Ask Jokes

What did the one electron say to the other when it asked it out on a date?

Get outta here, I'm not attracted to you!

What's black and white and can't turn around in a corridor?

A nun with a javelin in her throat. (The only joke I can ever recall when asked for one. Told to me by my art teacher in Grade 11. Needless to say, he was my favourite teacher)

Spirit Jokes More Spirit Jokes

How do you encourage a bartender?

That's the spirit!" How do you discourage a bartender Boos.

What's your spirit animal?

An eagle. They're so majestic." MEANWHILE Horse: hey eagle, what's your spirit human Eagle: this guy Dave

Pub Jokes More Pub Jokes

Why the big pause................................?

Said the man in the pub to the bear. First heard this joke told by Eddie Izzard.

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

Try Jokes More Try Jokes

How many tries did it take to find out if Lance Armstrong was ticklish?

One testtickle

Why did the poor dog chase his tail?

Because he was trying to make both ends meet.

James Bond Jokes More James Bond Jokes

How does James Bond sleep?

Around.

What type of car does James Bond drive?

00-Sedan

Destroy Jokes More Destroy Jokes

Why is CoD like women?

Search and Destroy.

Why do christians burn fossil fuels?

They're trying to destroy the evidence.

Family Jokes More Family Jokes

What is the difference between a black man and a couch?

A couch can support a family

Why did I join Twitter?

Well I was sick of only being hated by coworkers and family so I wanted to branch out.

Discourage Jokes More Discourage Jokes

What saying is discouraged in both the USA and North Korea?

The South Will Rise Again

How do you encourage a bartender?

That's the spirit!" How do you discourage a bartender Boos.