Bartender says, "dude, this is a gray bar.
I'm sorry, we don't serve food here
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Dude, I'd bankrupt you in a week. I'm just catchin Pokemon in your office."
And then THOSE horses rode MORE horses Then it's like, whoa dude! Check out that big stack of horses!
