Where is all the color white?

Bartender says, "dude, this is a gray bar.

Previous Random Joke Next

Bartender Jokes More Bartender Jokes

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Dude Jokes More Dude Jokes

What would you call the mailman if he got fired?

I don't know, just some dude.

How about if the villain is a psychopath out to make a skin suit?

Not in a kids movie, dude. "Ok, but it's puppy skin " - Oh, then YES!