Bartender says, "dude, this is a gray bar.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
You really crack me up dude!" The drug dealer responds with: "How much "
Just seems weird that there are that many dudes who salivate at the sight of a wiener.