And the bartender says, I don't know, but I've heard he's a shady character!
In honor of the recent joke trends I ask you what is the dirtiest joke you know?
A self-awarewolf.
The D is silent.
He heard the film had dogfighting scenes
No boos for me.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
