What did the bartender say to the jumper cables?

You better not try to start anything.

Previous Random Joke Next
Start Jokes More Start Jokes

Why do bakers start working so early in the morning?

Because they knead dough.

When's the best time of day to start a diet?

4:00 For:Klock

Try Jokes More Try Jokes

What's the difference between a feminist and a doormat?

You might try and knock some mud off on the sidewalk before you step on the doormat.

Where is the safest place to stay at Ferguson?

The public pool, if it is too crowded try the library.

Bartender Jokes More Bartender Jokes

How do you pay a bartender?

With bar tender.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Jumper Cable Jokes More Jumper Cable Jokes

What did the bartender say to the jumper cables?

You better not try to start anything.

What's the slowest thing in the world?

A: A Mexican funeral with only two sets of jumper cables.