What did the bartender say to the jumper cables?

You better not try to start anything.

Previous Random Joke Next
Start Jokes More Start Jokes

What did Mario say to Yoshi when he started climbing the Cherry tree?

X-post r/landscaping) Yoshino!!!

How does every racist joke start?

looks over both shoulders....

Try Jokes More Try Jokes

How can you tell if Asians have broken into your house?

The dog is gone, the homework is done, and they're still trying to get out of the driveway.

How did the polish terrorist burn his lips?

Burned them on a cars tailpipe when he tried blowing it up.

Bartender Jokes More Bartender Jokes

What did the bartender say to the jumper cables when they walked into the bar?

A: Ok you 2 dont start anything

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Jumper Cable Jokes More Jumper Cable Jokes

What did the bartender say to the jumper cables when they walked into the bar?

A: Ok you 2 dont start anything

What's the slowest thing in the world?

A: A Mexican funeral with only two sets of jumper cables.