When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

Previous Random Joke Next

Know Jokes More Know Jokes

Why do you love your puppy more than you love your wife?

Because the puppy only knows the tricks you taught her

Which is worse, insouciance or ignorance?

I don't know and I don't care.

Ask Jokes More Ask Jokes

How many "All Lives Matter" protesters does it take to change a light bulb?

None, because they keep on asking why all of the other light bulbs in the house aren't being changed at the same time.

How do you make stupid children?

I don't know, ask your parents.

Bartender Jokes More Bartender Jokes

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Ryan Lochte Jokes More Ryan Lochte Jokes

What will Ryan Lochte say if he looses "Dancing With the Stars"?

I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.

What would people call Ryan Lochte if he went to jail?

Ryan Locht-up