What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

Previous Random Joke Next

Harambe Jokes More Harambe Jokes

What will you be drinking?

Harambe: I'll have a beer Me: No, he'll have just ice Bartender: Just ice Me: Yes. Justice for Harambe.

What's the difference between Joe Paterno and Harambe?

Harambe tried to save the kids.

Drink Jokes More Drink Jokes

Which beer did the flower drink that made it realize that it was smarter when it was young?

Budweiser

What do you call a pirate who is lost at sea and has to drink his own pee to survive?

Aarrrrrrr Kelly!

Justice Jokes More Justice Jokes

What do you call a dead baby ,who fights crime?

Miscarriage of Justice

What will you be drinking?

Harambe: I'll have a beer Me: No, he'll have just ice Bartender: Just ice Me: Yes. Justice for Harambe.

Bartender Jokes More Bartender Jokes

Why the long face ?

A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Ice Jokes More Ice Jokes

What drink can I get you?

Just ice for Harambe"

What did Batman give Doctor Freeze with his whisky?

Just-ice