What position makes the ugliest children?

Ask your parents

Previous Random Joke Next
Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did Jared say when the girl asked him for a footlong?

That he only has a 6 inch.

Parent Jokes More Parent Jokes

How many Millennials does it take... to screw in a lightbulb?

None. Their parents will do it for them.

What do Jesus and a nerd have in common?

Both are long-haired, live at their parents' till their 30's, and if they'll do anything, it is considered a miracle.

Position Jokes More Position Jokes

What's the difference between a vacuum and a Harley Davidson?

The position of the dirtbag

Why are quantum physicists bad lovers?

When they find the position, they can't find the momentum. When they find the momentum, they can't find the position.