asking for a friend
Because they were tailor made for it.
As a Canadian, this offends me.
To catch everything that goes over their heads.
They caught him with an ounce of coke in his system.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
I'm sure my neighbors ask the same question every time they catch me in their house...taking a shower.
When she says she thinks of you like a brother.
Because he's Blind Married
It's hard to be thankful when KFC is closed
He moved down-under!!
