What does idk stand for?

Literally everyone I ask doesn't know.

Previous Random Joke Next

Know Jokes More Know Jokes

When your kid asks you (daddy is it time to go crazy?

you don't know what to say until you wife reply's (idk go ask you dad.) what do you say My little joke

What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

Stand Jokes More Stand Jokes

Why are football grounds odd?

Because you can sit in the stands but can't stand in the sits!

What did the hat say to the coat stand?

You stay here, I'll go on a head.

Ask Jokes More Ask Jokes

How many pixies does it take to screw in a light bulb?

Two, but don't ask me how they got in there.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Idk Jokes More Idk Jokes

What does a rotting corpse say?

idk

What happens when I die?

Idk...