What mistake did the chronometer make while it was getting along well with the digital watch?

It asked the digital watch for its hand in marriage.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What should have tipped off the airline ticket sellers on 9/11?

When the terrorists asked for anything cheaper than one-way.

Hand Jokes More Hand Jokes

What kind of tree fits in your hand?

A palm tree!

Why did the kidnapped clock always read 12:00?

His hands were tied.

Mistake Jokes More Mistake Jokes

Who did Chris Brown mistook Rihanna for?

Britney Spears

What does a muslim say when he makes a mistake?

Allahu Mybad

Marriage Jokes More Marriage Jokes

What's the difference between a princess and a witch?

2 years of marriage.

What two words result in the most marriages?

Screw it. EDIT: has a better answer lol