How many people does it take to change a light bulb?

Is just one of the questions I should have asked before buying a lighthouse....

Previous Random Joke Next
People Jokes More People Jokes

What's the difference between people on Reddit and dead people?

Dead people had lives.

Why do people with no arms have difficulty remembering?

Because they can't put their finger on it.

Change Jokes More Change Jokes

How many eye doctors does it take to change a lightbulb?

One, or two? One, or two?

How many firemen does it take to change a light bulb?

Four - three to cut a hole in the roof and one to change the bulb.

Light Bulb Jokes More Light Bulb Jokes

How many black people does it take to screw in a light bulb?

3/5

How Many Business Analysts Does It Take To Change A Light Bulb?

None. The light bulb shall never burn out. (OK. It's more cathartic than funny...)

Ask Jokes More Ask Jokes

What does idk stand for?

Literally everyone I ask doesn't know.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Buy Jokes More Buy Jokes

What kind of pants do you buy for your pet Chihuahua?

Shorts!

When you wife asked you to buy her car, why did you buy her a diamond instead?

Because I couldn't find a fake car."

Question Jokes More Question Jokes

What State do you go to to ask questions?

Al-ask-ya

What do you call a loonie answering questions on reddit?

DollarAMA. *Only Canadians will get it, sorry.

Lighthouse Jokes More Lighthouse Jokes

What did the ocean say to the lighthouse?

Nothing, it waved.

How many people does it take to change a light bulb?

Is just one of the questions I should have asked before buying a lighthouse....