When you wife asked you to buy her car, why did you buy her a diamond instead?

Because I couldn't find a fake car."

Previous Random Joke Next

Car Jokes More Car Jokes

What did the car said to the valet?

I've been through a lot.

How did a blind man drive his car?

A: One hand on the wheel the other on the road.

Find Jokes More Find Jokes

Why don't cows drink milk?

because they lactose I don't know why I found this so funny! ready for the down vote to begin 3

Why can't the incredible hulk find a girlfriend?

Because all the girls know he just wants to smash

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

How many blondes does it take to change a diaper?

Ask Hugh Hefner.

Buy Jokes More Buy Jokes

How many people does it take to change a light bulb?

Is just one of the questions I should have asked before buying a lighthouse....

Why did the iPhone 7 cross the road?

To buy another pair of AirPods.

Diamond Jokes More Diamond Jokes

What does marriage have in common with a deck of cards?

In the beginning, you only need two hearts and a diamond. Later on, a club and a spade.

What do you call a lump of coal and a diamond hanging out together?

Carbon Dating.