What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

Previous Random Joke Next
Want Jokes More Want Jokes

Why did the hotel refuse hospitality to the Navy?

They didn't want their rooms covered with seamen.

Why'd the robber take a bath?

A: He wanted to make a clean getaway.

Know Jokes More Know Jokes

Why couldn't the blonde write the number ELEVEN?

A: Because she didn't know which one came first!

Which I replied, "Wanna know whats also the size of Australia?

Australia.

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What would Arnold Schwarzenegger say if you asked him his favorite holiday?

You have to love easter, baby." (OC)

Friend Jokes More Friend Jokes

What's you experience with "Friends with benefits"?

The close thing I came to having friends with benefits was .......... convincing my friend to bring food for me daily.

What is the difference between confident and confidential?

Dad says: "You are my son, I'm confident about that. Your friend over there, is also my son, THAT is confidential.

Dinner Jokes More Dinner Jokes

What did the fruit say to the vegetable before dinner?

Lettuce, pray.

How do Batman's parents call him to dinner?

They don't they're dead.

Watson Jokes More Watson Jokes

What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

What up Holmes?

Watson

Sherlock Jokes More Sherlock Jokes

What do you call a smart mexican?

Sherlock, Holmes.

What did the elephant say to the famous detective ?

It's ele-mentary my dear Sherlock !

Menu Jokes More Menu Jokes

What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

Why was the gourmet upset when he saw the menu?

The prices were gastronomical... (I'll show myself out...)