Whenever a waiter asks, "Do you want to hear about our specials?

push the menu aside and softly whisper, "I want to hear about you."

Previous Random Joke Next
Want Jokes More Want Jokes

How many paranoids does it take to change a lightbulb?

Who wants to know?

Why do beavers spend a fortune on the Internet?

They never want to log off.

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

How much ice does it take to preserve a dead body?

I ask on twitter because googling it gets people caught.

Hear Jokes More Hear Jokes

Whats the difference between a baby and a trampoline?

You take your shoes off before you step on a trampoline Probally heard this but it's worth a shot

Who wants to hear an appendectomy joke?

Removed

Push Jokes More Push Jokes

Why are you always pushing me around and talking behind my back?

I said, "well, you are in a wheelchair".

Where is the best place to screw a Mt. Goat?

The edge of a cliff, you are guaranteed she will push back!

Waiter Jokes More Waiter Jokes

What did the Australian Chess player say to the waiter?

Cheque, mate!

How long must I wait for that turtle soup I ordered?

Waiter: Well you know how slow turtles are.

Menu Jokes More Menu Jokes

Whenever a waiter asks, "Do you want to hear about our specials?

push the menu aside and softly whisper, "I want to hear about you."

What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

Special Jokes More Special Jokes

Why doesn't this restaurant have any specials?

Waiter: Because nothing about this food is special.

Whenever a waiter asks, "Do you want to hear about our specials?

push the menu aside and softly whisper, "I want to hear about you."