Turn the barstool upside down.
Couple's Daily Question Mug
Coffee Mug
No have to cut me off. Fall off barstool by myself. end metajoke
Flip it upside-down.
They go into their igloos and sit around a candle. What do they do when it gets even colder They turn on the candle.
To get to the other side. He then turned around, stuck up his middle finger and said, "Hah, you were all expecting a joke, and all you got was an Anthony joke!"
We sleep better when the room is moving
A seamen sample
You can only fit 3 fingers in a can of Copenhagen.
Pigs don't fit in chimneys.
Hau Ling.
A: A car thief who can't drive!
asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
The Tchernobyl cowboy.
Because he is 2 square.
He flips houses
Because she's always drinking from the coup de Grace. (This was my sister's favourite joke when we were kids. Once our mum flipped out on a long car journey because she told it too many times).
Ow, this really hertz.
Believing that one day, the chicken will cross the road, it fills you with determination.
