Weasel Jokes

What's the difference between a stoat and a weasel?

One is weasily recognised and the other is stoatally different

Interactive Joke of the Day Mug

Interactive Joke of the Day Mug

Coffee Mug

What do you get when you cross a weasel with a whale?

A reprimand from the Scientific Ethics and Integrity Committee and an immediate withdrawal of your grant funding.

What's the difference between a weasel and a stoat?

One's weasily recognised - the other's stoatally different

How can you tell the difference between a weasel and a stoat?

One is weasely identifiable while the other is stoatally different.

What about the weasel?

That's the punchline. Comment with the lead up and may the best one win.

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

You might also enjoy:

Walk Jokes More Walk Jokes

What did the first ape that could walk say to all the other apes?

I'm walkin' here!

What does an Italian sound like walking through the rain?

Dago wop wop wop

Bar Jokes More Bar Jokes

What's the difference between Russian football fans and an old drunkard in a bar at closing time?

Kicking the old drunkard out won't start world war III.

What do a woman and a bar have in common?

Liquor in the front, poker in the back.

Bartender Jokes More Bartender Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did the bartender say to the angry speaker?

We don't want any treble

Immediate Withdrawal Jokes More Immediate Withdrawal Jokes

What do you get when you cross an octopus and a lion?

A stern rebuke from the ethics committee and an immediate withdrawal of funds.

What do you get when you cross a cow with an octopus?

Reprimand from the university ethics board and immediate withdrawal of all research grants.

Lead Jokes More Lead Jokes

What's the difference between organized crime and the government?

Only one of them is organized. Couldn't help but post this. Went to see a former mafia boss today, and that joke was told leading up to him speaking.

How do you estimate your kids lifespan?

Hand them a mechanical pencil with the lead out and see how the use it. Child A: look mom I'm a doctor! - expect them to live to 80+ years. Child B: look mom I'm a heroin user! - expect them to live to about 27.

Tell Jokes More Tell Jokes

How can you tell if somebody's run a marathon?

Wait 15 seconds, they'll tell you.

How do you tell apart a Chinese from a Japanese?

With a Geiger Counter.

Serve Jokes More Serve Jokes

Why is revenge a dish best served cold?

Because it's just-ice

What do you call a professional tennis player that keeps serving out?

Novak Chokeovic

Reprimand Jokes More Reprimand Jokes

What do you get when you cross a cow with an octopus?

Reprimand from the university ethics board and immediate withdrawal of all research grants.

What do you get when you cross a weasel with a whale?

A reprimand from the Scientific Ethics and Integrity Committee and an immediate withdrawal of your grant funding.