What's the difference between toilet paper and a knife?

Oh, you don't know I won't ask you to wipe my bum then.

Previous Random Joke Next
Difference Jokes More Difference Jokes

Whats the difference between Electricians and Technicians?

You don't have electricians that are colour blind!

What's the difference between a condom and a coffin?

Well, both carry stiffs, but one's for coming and the other's for going.

Know Jokes More Know Jokes

How do you know when the drummer has shown up for band practice?

He won't stop banging at the door.

How do you know when a vegan gets to the party?

Don't worry, they'll tell you.

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Why the long pause?

asks the bartender. The bear replies "Well, I am a bear"

Toilet Paper Jokes More Toilet Paper Jokes

What do you get when an alternative metal band runs out of toilet paper?

Rage Upon the Latrine

Why did the toilet paper roll down the hill?

To get to the bottom

Knife Jokes More Knife Jokes

What's 7 inches and makes women submissive?

A knife.

Why do you carry a knife?

Me: A sword is harder to hide.

Bum Jokes More Bum Jokes

Why are British anti-smoking PSA's often made by homophobes?

Because they want to prevent people from bumming fags

What's the difference between toilet paper and a knife?

Oh, you don't know I won't ask you to wipe my bum then.

Wipe Jokes More Wipe Jokes

What do you call it when you keep wiping but brown still shows?

The Trail of Smears

How does the blind man know when to stop wiping his arse?

I don't know, that's why I'm asking you.