Thanks for the gold!
Interactive Joke of the Day Mug
Coffee Mug
Thanks for the gold, kind stranger!
Au.
Add 24 carrots
Being normal.
Au, yeah!
Having legs.....
In his treas-arrrr chest!
Having a pair of legs...... I know, I know, I'm going to hell
amuse me first...hahaha
The redditor never gets gold
Couple's Daily Question Mug
Start a war.
You add 24 carats!
Someone threw a fridge at him.... Gold
Absolutely Auful!
He's the one with the gold Rolex around his neck.
Gold
Au!"
Stay gold, Ponyboy.
White and gold.
Walking
A! U!!! If it doesn't make sense tell it so someone out loud. Pretty sure this is my first original joke :)
AU GUYS!!!
By holding the bulb up to the socket and waiting for the world to revolve around them EDIT: Rip inbox EDIT 2: Thanks for the gold!
You hide their food stamps under their work boots. Edit Thank you /u/DoctorBrohoof for my first gold!
A-U" :
In a croak of gold at the end of the rainbow !
Wash it up over and over again until you get gold!
Because pyrites arrrrrr everywhere
Pupil : It's stolen !
I'm pretty sure I saved it to make reference to eventually and now I cannot find it. There was some gold in there.
They both slowly remove clogs. I'll see myself out... Hey, at least it was original. Thanks for the gold !
AU, get outta here!"
Zikachu.
Cheer-Rios
They want to look like their mothers.
gnocchi
Bartender says, "dude, this is a gray bar.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
It makes the Dego buy faster.
The Italian. The black is tied to the tree.
They're both gold-diggers
Goldman Sachs
Because he was married
Because he feels for everyone.
Having two legs
Because all their swimmers, runners, and high jumpers are in USA.
Because all their best runners, jumpers, and swimmers are in America.
Nothing, it's a free country.
