Hay,I thought you knew horses couldn't speak!
Interactive Joke of the Day Mug
Coffee Mug
Talibanter
I don't know nobody has ever made it across.
The NaaaaayyyVY
The mare, of course
Unicorny
Mayonneighs
A Khalculator
A hippocratic hypocrite.
Horses
A-neigh
Couple's Daily Question Mug
A stable economy
A Neigh-bor. Sorry for my horrible dad joke.
Everest. Any time he is bored I see him Mount Everest.
None. Horses are not known to use operating systems nor computers for that matter.
Sarah Jessica Parkour
Jockey straps.
Merci.
It didn't have a stable relationship.
He was gelded.
Because he's a horse racist.
Horse rddish.
They have a lot of moo/neigh.
They get BUCKED up!
Hay bail.
He was de-stable-ized.
An Hippic fail.
A gallop poll.
A Horse.
A Nightmare
Their neighbor
Neightiri.
A horse
Texans tend to ride horses whereas rednecks ride their cousins. -American Sniper
Because she was too ahoof.
Because they're all in relationships!
The horse knows when I'm grooming him.
A lawyer.
I've fallen and I can't giddyup.
Because Mr. Sippi is hung like a horse.
Nine. One to do the shoeing, and eight to lift up the horse!
When you put your hand down her pants you think you're feeding a horse.
A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.
The horses would drown. Ba-dum TISH
You don't. You get down from a duck.
Because their horses would drown.
Worthless
A horse made by committee.
An horse.
The orange has handlebars
He went on furlong-er.
They both paralyze superman
Whoa.
sees a giraffe for the first time Okay, what the hell is going on today
Call triple neighhh!
bartender: Why the long face Horse: My alcoholism is destroying my family.
He was always horsing around.
A: Saddle-lite TV
Giddy up horsey !
Try two pairs of stilts!
A horse !
A one trip pony :D
They're on a stable diet.
Because they're nay sayers.
A knight in Charmin armor.
You don't ride horses. Me: Why do you wear sneakers You don't sneak.
A Zebra.
ouch..."
He tried to stirrup some interest!
A neighbor (naybor for pessimist horses)
Mentally in-stable.
You take away his food.
He had the knight off!
Neigh-boars.
A: A hobby horse.
It bucked!
I wish I could hear you whinnie.
Yankee poodle!
Unstable
Put a brick under each hoof!
You don't, you get down off a duck.
A zebra.
Ralph Neighder!
Sarah Jessica Porker
Help! I've fallen and I can't giddy up."
The NEIGHHHHHHborhood
He thought he might get a kick out of it!
An Appaloosa!
Because he could only say, "neighn!"
They're always switching their tails!
Because it's covered with horsehide!
Jee hawd!!!!!!!!!!
A: I dunno, but if it bites you, you can ride it to the hospital!
In the Sir Lance Lot
3-year-old: Woof woof. Me: Horses 3: Neigh. Me: Pigs 3: Sizzle sizzle. Somebody understands bacon.
Mascarpone!
Cause their answer is always 'nay'. I'm sorry, I'll leave...
If one bit you you could ride it to hospital !
For palomino-money!
Glue.
I have made a grave mistake.
They're trying to get away from the noise.
One goes to the bar for a cold one. The other goes to a morgue.
Tekira!
asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Tequila
Unix
An emoji... Emo g, get it? From my 13 year old son
A pimple waits until you're 13-years-old before coming on your face.
Look, no hands!
A: A red bucket in disguise.
Latvian say, "I was thinking of my daughter. She has been lie with soldier for potato feed baby."