Ask Jokes

the surgeon asked the patient that was about to be anesthetized. "But doc this is my first operation." "Really It's mine too and I am not excited at all."

Why don't you ask about the home life of a filing cabinet?

It's usually a sorted affair.

What do you call an awkward questioner?

I don't KNOW, that's why I **asked** you. God.

Interactive Joke of the Day Mug

5.0

Coffee Mug

What did the pirate say when asked how old he was?

Aye Matey!

Who, you ask, turns the AC on during a polar vortex?

Sociopaths, fascist dictators, my boyfriend.

What did the lawyer say to the sovereign citizen when asked for legal counsel?

Am I being retained ** **Am I being retained **

What does a blonde say when you ask her if her blinker is working?

A: Yes. No. Yes. No. Yes. No. Yes. No. Yes. No.

Why do you think I spend too much time at my computer?

Well dear... Every time I ask you to close the windows you answer with "Please wait while your computer shuts down"...

What's wrong with these eggs I ordered?

Waiter: Don't ask me. I only laid the table.

How does a witch doctor ask a girl to dance ?

Voodoo like to dance with me '

What did one Melon say to the other after it was asked marry it?

We Can't Alope

How do you make a motherboard?

I asked him. He said, "Tell her about my job."

What haircut did the Texan barber recommend when asked?

He couldn't think of anything, and said "I'll mullet over"

What's the worst question you can ask a blind date?

So.. you seeing anyone "

What did the bunny ask his boss for?

A raise in *celery*.

How can I buy the New York Times?

He replies "Ask my wife. She'll tell you how you do it.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What ringtone have you got?

Murphy asked Paddy, "What ringtone have you got " Paddy said, "I've never really looked, but probably light brown

What's the best way to milk a sheep?

Ask Apple.

What about the kids?

he asked. I said, "they're still together."

What did the girl sea say when the boy sea asked her for a date?

Shore.

Who would you ask for advice about a lion?

a lion or a gerbil The lion, because by virtue of being a lion, a lion is an expert on lions.

What did little Paul Bunyan say when his mom asked him how he damaged his favorite toy?

It was an ax-I-dent.

What did the throwing star say when I asked her if she could hit her target?

Of course, I'm shuriken.

What would you guys like to ask an American?

Nevermind they'll just tell you anyway

When I asked her why, she said "uhhh no real reason". I'm thinking, "no reason, huh?

So I punched her in the face. Now she has a reason.

What does Shaggy ask himself when he's in a bind?

What would Scooby doo

How many plug-in air fresheners does it take to mask the decay of human flesh?

I'm asking for for a friend.

How soon?

the frail man asked, his body trembling at every word. "In ten." "Ten what Ten years Ten-" "Nine." "Eight."

What did one bodybuilder ask the other?

How much do you whey bro

What products do you use for grooming?

she asked me. Her face looked quite taken aback when I said, "Facebook"

Whatever's the matter ?

asked her mother. 'I don't know' replied Mary 'but the teacher thinks I may have caught decimals.'

What do you ask a Mexican girl you like?

Netflix and chili

What did Gandhi say to the British, after they asked him to move?

Nah, mastay

What should you do if a bird poos on your car?

Don't ask her out again

What are we waiting for?

the doctor asks. "Patients, Doctor," replied the nurse. "Patients."

Why is this wet?

she asks. "Because it's below C level."

What did the judge ask when he went to the dentist?

Do you swear to pull the tooth, the whole tooth and nothing but the tooth

Why do I need the life vest?

Me: If you have to ask, you might not need one.

What did Pitbull ask for Christmas?

Dolly.

What's your favorite kind of music?

Asked one windmill to another. The windmill responds, "I'm a metal fan."

What do you do if you lose all the information on your computer?

Ask the NSA for a backup.

What did my roommate say when I asked him if he wanted to watch the movie The usual Suspects?

Is it about black people

What light through yonder window breaks?

ME:Well if you'd just sod off like I asked, I wouldn't have to throw lamps at you.

When my wife got her tongue pierced I asked her why?

She said To enhanthe the thektual thimulation.

When ur at chipotle n u ask for guac and they say "its extra is that ok?

if u say its not ok they give it to u for free

Why do people say its not you... it's me in a breakup?

Yeah it's YOU, you're an idiot! I'm amazing... ask your brother!

How many blondes does it take to change a diaper?

Ask Hugh Hefner.

How many women have you slept with wife asked husband, "How many women have you slept with?

he proudly replied, "Only you, Darling. With all the others I was awake."

What's the worst thing about being a Jehovah's witness?

Nobody asks, 'who's there ' when you try and tell a knock knock joke.

What did the blind man say when he was asked what he thought about the renovation plan of his house?

I don't know.. I just don't see it.

How was your interview?

Munnu : It went good, but lastly they asked me show them my testimonial. Chunnu : So Munnu : I think I showed them the wrong thing.

How can you tell a gamer from a rugby player?

Ask them if they play league.

What did the Canadian say when asked what he thought about stereotypes?

Eh.

Where can you go on Reddit to ask questions?

Not /r/movies.

How many "can't"s can a white girl "can't" before she literally can't even?

my brother asked me this when i woke up and it has been bugging me all day.

When someone ask me... How are you?

I answer back... You mean in bed

Why did the stupid racing car driver make ten pit stops during the Grand Prix?

He was asking for directions.

What do you call a pregnant nun who cycles to church everyday?

No seriously, a friend asked me this and I didn't know.

What do I owe ya?

asks the neutron. "For you No charge."

How many Chinese workers does it take to make a Smartphone?

I dunno. Ask the kids.

Why don't you play with your friends?

he asked. 'Because I only have one friend' the girl replied. 'And I hate her.'

Whats worse than Bad command or File name?

Windows update message asking you to restart your computer

How do you spell wrong?

R o n g. That's wrong. That's what you asked for isn't it

What did the pig do when a beetle landed in his feed trough?

He ate it quickly before the others could ask him to share.

Who currently provides your Internet?

he asked. I said, "My next door neighbour."

Why did the stutterer get shot in the ghetto?

He was asking for directions for the "k-k-k-mart."

What is the best kind of dog to ask for directions?

A Chihuahua because it knows all the shortcuts!

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

What's the bad news?

Asked the patients. "You only have 24-hours to live." "And the really bad news " I should have told you yesterday.

When I was just a little girl I asked my mother, what will I be?

Will I be pretty Will I be rich Here's what she said to me No

What kind of sandwich is this?

She asks. "It cheese ma."

Why not ask the guy who took that picture?

Just kidding, I ran over it.

What does the neckbeard say when asked what he did last weekend?

M'laundry."

How do you spell ichael?

The teacher was rather bewildered. "Don't you mean Michael " she asked. "No ma'am. I've written the 'M' already."

What did the Mexican princess ask her sister?

Tijuana build a snowman

How do you know if your friend, "Doesn't even OWN a TV?

Because it's this answer to every question you ask them. "Did you hear about the President's new policy on... " "I don't even OWN a TV!"

How many reps would you usually do?

he asked. "A million," I rep lied.

Which is farther away- NY City or the moon?

Sister: NY City. Why do ask Brother: Well I can see the moon but I can't see NY City.

What did the vulture say when the airline agent asked if he wanted to check his luggage?

No, thanks, it's just carrion...

When I have complicated problems I always ask myself, what would my imaginary wife do?

And then I end up buying myself cupcakes, and shoes.

What did Sherlock ask his friend when he wanted to know what they were having for dinner?

Watson the menu

What's the worst part of locking your keys in the car at an abortion clinic?

Having to go inside and ask for a coat hanger.

This joke may have profanity.

What did Julius Caesar ask when finding a color to paint the Senate?

Ecru, Brute "

What does COINCIDENCE' mean?

Student Funny, I was just going to ask you that.

What did the German say when the Spaniard asked him for some cheese?

Mi Kase es su Kase.

What do you tell a girl who won't stop asking for a tampon?

Put a sock in it.

What did the World Chess Champion ask Michael Jackson?

Do you want to be black, or white

When the cashier asks me "Is that everything?

I feel like crap inside because obviously my order didn't satisfy her.

Why didn't the skeleton ask out the Zombie to go to the Halloween party?

He didn't have the guts

What makes you think you can criticise American gun laws, sitting over there in the UK?

I was asked on an internet forum. "Because you're not allowed to take them on planes," I answered.

Whats the worst thing about getting your keys locked in your car outside an abortion clinic?

Having to go inside to ask for a coat hanger.

This joke may have profanity.

You might also enjoy:

Reply Jokes More Reply Jokes